View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6868A_low_227 (Length: 243)
Name: NF6868A_low_227
Description: NF6868A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6868A_low_227 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 15 - 243
Target Start/End: Original strand, 25696905 - 25697133
Alignment:
| Q |
15 |
atggacatcagacacgacactgacaataataagtagacattggtaataattttcgaaaactggatgtaaccacgtgtgttggtgttcaatctaaagtctt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25696905 |
atggacatcagacacgacactgacaataataagtagacattggtaataattttcgaaaactagatgtaaccacgtgtgttggtgttcaatctaaattctt |
25697004 |
T |
 |
| Q |
115 |
gctgctacattgatatgaatatatttgatagacaagatcaatttttggactaggattgatgtgcatcacctatgtaacgttgatgtttgaattaactcct |
214 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
25697005 |
ggtgctacattgatatgaatatatttgatagacaagatcaatttttggactaggattgatgtgcatcacctatgtaacgttgacgtttgaattaactcct |
25697104 |
T |
 |
| Q |
215 |
ttaaagtgagcaattcaaattagaggaaa |
243 |
Q |
| |
|
||||||||||||||| | ||||||||||| |
|
|
| T |
25697105 |
ttaaagtgagcaatttacattagaggaaa |
25697133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University