View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6868A_low_228 (Length: 243)
Name: NF6868A_low_228
Description: NF6868A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6868A_low_228 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 17 - 213
Target Start/End: Complemental strand, 16200051 - 16199855
Alignment:
| Q |
17 |
ggacatcatgtatagtacaaagtgagaaggacccaggcatatatataacaaagaaatcataagtgaaatcctaacgtagacataaaatcaatgttttaaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
16200051 |
ggacatcatgtatagtacaaagtgagaaggacccaggcatacatataacaaagaaatcataagtgaaatcctagcgtagacataaaatcaatgttttaaa |
16199952 |
T |
|
| Q |
117 |
aattgaaccaaacagttcagcctgtcgaaccataaaacggcactgaatatggttcatctatttaagcggtttgattgcggtttcgtcccaattcgag |
213 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16199951 |
aattgaaccagacagttcagcctgtcgaaccataaaacggcactgaatatggttcatctatttaagcggtttgattgcggtttcgtcccaattcgag |
16199855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 213 - 243
Target Start/End: Complemental strand, 16199832 - 16199802
Alignment:
| Q |
213 |
gatcccgagatttcaccagttcgatgttcac |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
16199832 |
gatcccgagatttcaccagttcgatgttcac |
16199802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University