View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6868A_low_233 (Length: 243)
Name: NF6868A_low_233
Description: NF6868A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6868A_low_233 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 15 - 224
Target Start/End: Original strand, 34435858 - 34436067
Alignment:
| Q |
15 |
acatcacacatcaatagtttaatgcatatgaacaaatgttttaaatcagtcgcactgcaattgcgaaatattgtggtcgaatagaattgatgtaactgta |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34435858 |
acatcacacatcaatagtttaatgcatatgaacaaatgttttaaatcagtcgcactgcaattgcgaaatattgtggtcgaatagaattgatgtaactgta |
34435957 |
T |
|
| Q |
115 |
attgcgattttcatacggttgttgagagataaaaaatcttgacgttgcaactatagccgtggttacaaaaccgttttacagaaccttgatttgaagctat |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34435958 |
attgcgattttcatacggttgttgagagataaaaaatcttgacgttgcaactataaccgcggttacaaaaccgttttacagaaccttgatttgaagctat |
34436057 |
T |
|
| Q |
215 |
gattatttct |
224 |
Q |
| |
|
|||| ||||| |
|
|
| T |
34436058 |
gattttttct |
34436067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University