View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6868A_low_281 (Length: 230)
Name: NF6868A_low_281
Description: NF6868A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6868A_low_281 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 23378240 - 23378010
Alignment:
| Q |
1 |
aatttagggttttaaggtgatttaagagtgaggactgaaaaaatgtgcatgaggatttggtgactcttatgggtgaacataattggattgtgagatgtta |
100 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
23378240 |
aatttagggttttgaggtgatttaagagcgaggactgaaaaaatgtgcatgaggatttggtgactcttatgggtgaacataattggattgtgagatcaaa |
23378141 |
T |
|
| Q |
101 |
--tgttcattgagaagtcaatcaatgtgcttaatgtcttgctactcttggttataatgaaagacttgattcgacaaaactctcatccccaaccttcttta |
198 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23378140 |
catattcattgagaagtcaatcaatgtgcttaatgtcttgttactcttggttataatgacagacttgattcgacaaaactctcatccccaaccttcttta |
23378041 |
T |
|
| Q |
199 |
ttttttattacttcataatgattgtagaatga |
230 |
Q |
| |
|
| |||||||||||||||||||||||||||||| |
|
|
| T |
23378040 |
t-ttttattacttcataatgattgtagaatga |
23378010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University