View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6868A_low_299 (Length: 229)
Name: NF6868A_low_299
Description: NF6868A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6868A_low_299 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 18269940 - 18270168
Alignment:
| Q |
1 |
tcaacctaatgataacaagcccaattttctgcaatatgaagacactgttgaagacaactacagtgaatcatggtggctagaagcgataaaaggagttgag |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
18269940 |
tcaaccgaatgataacaagcccaattttctgcaatatgaagacactgttgaagacaactacagtgattcatggtggctagaagcgataaaagtagttgag |
18270039 |
T |
|
| Q |
101 |
gaagtggagaataagaaaactgcaacagagctatgcagcaaggttagtctgtcttaatttagctttcccttgttatcttgtttaacaataggactgaagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18270040 |
gaagtggagaataagaaaactgcaacagagctatgcagcaaggttagtctgtcttaatttagctttcccttgttatcttgtttaacaataggactgaagc |
18270139 |
T |
|
| Q |
201 |
cctatcccctctatttagacggcatagga |
229 |
Q |
| |
|
|||||||||| |||||||||||||||||| |
|
|
| T |
18270140 |
cctatcccctttatttagacggcatagga |
18270168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University