View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6868A_low_317 (Length: 224)
Name: NF6868A_low_317
Description: NF6868A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6868A_low_317 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 39480431 - 39480654
Alignment:
| Q |
1 |
aactatagctgggaattttctgtcaagtgtgcttgctccaatagttgcaatccaaggagcatcattggcaacagccatcgccattgggccattgtttcct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39480431 |
aactatagctgggaattttctgtcaagtgtgcttgctccaatagttgcaatccaaggagcatcattggcaacagacatcgccattgggccattgtttcct |
39480530 |
T |
|
| Q |
101 |
gccgcacatataactgaaatccctttctccattgctcgaaagcttccaatggcaatactatcatcatatagtggcaccgggaaaccgcctagagacaagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
39480531 |
gccgcacatataactgaaatccctttctccattgctcgaaagcttccaatggcaatactatcatcatatagtggcaccgggaaaccacctagagacaagg |
39480630 |
T |
|
| Q |
201 |
atagaacgtccacaccgtctctga |
224 |
Q |
| |
|
|||||||||||||||| ||||||| |
|
|
| T |
39480631 |
atagaacgtccacaccatctctga |
39480654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University