View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6868A_low_326 (Length: 221)
Name: NF6868A_low_326
Description: NF6868A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6868A_low_326 |
 | |
|
| [»] chr1 (3 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 1e-86; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 17455229 - 17455007
Alignment:
| Q |
1 |
gactatgttgtgcaatgaagtgtggatttcccggttgaatgtacatttcagcatcaatttcatcatcttcaaggtttgaacttgcagagctgcttccaat |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
17455229 |
gactatgttttgcaatgaagtgtggatttcccggttgaatgtacatttcagcatcaatttcatcgtcttcaaggtttgaacctgcagagctgcttccaat |
17455130 |
T |
|
| Q |
101 |
gtcccctnnnnnnnnnn--tcatttggtaatgcatgcataagtacatatagaaatgaaaaattaaaataacaattttatcttcggtatgatgtcaaaact |
198 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17455129 |
gtcccctaaaaaaaataaatcatttggtaatgcatgcaaaagtacatatagaaatgaaaaaataaaataacaattttatcttcggtatgatgtcaaaact |
17455030 |
T |
|
| Q |
199 |
tacatgctttgcaggttctacaa |
221 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
17455029 |
tacatgctttgcaggttctacaa |
17455007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 11 - 107
Target Start/End: Original strand, 17393653 - 17393749
Alignment:
| Q |
11 |
tgcaatgaagtgtggatttcccggttgaatgtacatttcagcatcaatttcatcatcttcaaggtttgaacttgcagagctgcttccaatgtcccct |
107 |
Q |
| |
|
|||||| ||||| ||||||||||||||||| || ||||||||||||||||| ||||||||||| ||||| | |||||||||||| ||||||| |||| |
|
|
| T |
17393653 |
tgcaataaagtgaggatttcccggttgaatatatatttcagcatcaatttcgtcatcttcaagttttgatcgtgcagagctgctcccaatgttccct |
17393749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 17 - 101
Target Start/End: Complemental strand, 17461447 - 17461363
Alignment:
| Q |
17 |
gaagtgtggatttcccggttgaatgtacatttcagcatcaatttcatcatcttcaaggtttgaacttgcagagctgcttccaatg |
101 |
Q |
| |
|
||||| ||||||||| || ||||| |||||||||||||||||||||||||||||||| |||| | ||||||||| ||||||||| |
|
|
| T |
17461447 |
gaagtatggatttcctggctgaatatacatttcagcatcaatttcatcatcttcaagatttggagctgcagagctacttccaatg |
17461363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 24 - 101
Target Start/End: Original strand, 40235153 - 40235230
Alignment:
| Q |
24 |
ggatttcccggttgaatgtacatttcagcatcaatttcatcatcttcaaggtttgaacttgcagagctgcttccaatg |
101 |
Q |
| |
|
|||||||| || ||||| ||||||||| |||||||||||||||||||| | |||| | ||||||||||||||||||| |
|
|
| T |
40235153 |
ggatttcctggctgaatatacatttcaacatcaatttcatcatcttcatgttttggagctgcagagctgcttccaatg |
40235230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 177 - 221
Target Start/End: Original strand, 40235321 - 40235366
Alignment:
| Q |
177 |
tcttcggtatgatgtcaaaa-cttacatgctttgcaggttctacaa |
221 |
Q |
| |
|
||||| |||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
40235321 |
tcttcagtatgatgtcaaaaacatacatgctttgcaggttctacaa |
40235366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University