View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6868A_low_329 (Length: 220)
Name: NF6868A_low_329
Description: NF6868A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6868A_low_329 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 25 - 217
Target Start/End: Original strand, 12466865 - 12467058
Alignment:
| Q |
25 |
cgatgaaattgaaatttgagaagagtcttgcaaaaagagacnnnnnnnngaaaa---tttaagtgtcttagtaataataaaagaggagagataacaacat |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||| || |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
12466865 |
cgatgaaattgaaatttgagaagagtcttgcaaaaagagacaaaaaaaaaaaaaaaattaaagtgtcttagtaataataacagaggagagataacaacat |
12466964 |
T |
 |
| Q |
122 |
aatctctaaacaccagattatatgaatgtcatataaatttggtggaacgattttaaccaataaatacaagtgtgctaaaagtgtgatgatgatatt |
217 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12466965 |
aatctctaaacaccagattatatgaatctc--ataaatttggtggaacgattttaaccaataaatacaagtgtgctaaaagtgtgatgatgatatt |
12467058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University