View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6868A_low_33 (Length: 410)
Name: NF6868A_low_33
Description: NF6868A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6868A_low_33 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 295; Significance: 1e-165; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 295; E-Value: 1e-165
Query Start/End: Original strand, 112 - 410
Target Start/End: Complemental strand, 46009149 - 46008851
Alignment:
| Q |
112 |
gtgaagattgaaataattggtacctgtttttgagctggaagagaagggtgtgttttgagatggagaagatttgggacattgttgttagaaattggatgag |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46009149 |
gtgaagattgaaataattggtacctgtttttgagctggaagagaaaggtgtgttttgagatggagaagatttgggacattgttgttagaaattggatgag |
46009050 |
T |
|
| Q |
212 |
ttctcttgctattggttttgatatcactagctctagtggttatgaatgattcttcttgcttgtttctgattgatgatgatttctgaggaggcttgtttct |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46009049 |
ttctcttgctattggttttgatatcactagctctagtggttatgaatgattcttcttgcttgtttctgattgatgatgatttctgaggaggcttgtttct |
46008950 |
T |
|
| Q |
312 |
gtttatccgtggactcaaattcccatgtgctgttttcttgcattttgggaaagattttttgtcctccttctctgacattgcttgtgtttgtggctttgt |
410 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46008949 |
gtttatccgtggactcaaattcccatgtgctgttttcttgcattttgggaaagattttttgtcctccttctctgacattgcttgtgtttgtggctttgt |
46008851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University