View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6868A_low_331 (Length: 220)
Name: NF6868A_low_331
Description: NF6868A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6868A_low_331 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 22 - 211
Target Start/End: Original strand, 6112664 - 6112846
Alignment:
| Q |
22 |
taatccatatatggggcaaacttttgactaagatgtgaacgttaatctactcctaagtcctaacatattcaacagtttaaaacaaacaaaacttgccttt |
121 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
6112664 |
taatccatatatgtggcaaacttttgactaagatgtgaacgttaatctactcct-------aacatattcaatagtttaaaacaaacaaaactttccttt |
6112756 |
T |
|
| Q |
122 |
attttgaattcatatcaaatgctttataccaaaatcctcacaaagagaacggtttattaagttaaatcatgttagaaatgatgtccatct |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6112757 |
attttgaattcatatcaaatgctttataccaaaatcctcacaaagagaacagtttattaagttaaatcatgttagaaatgatgttcatct |
6112846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University