View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6868A_low_333 (Length: 219)
Name: NF6868A_low_333
Description: NF6868A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6868A_low_333 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 40 - 197
Target Start/End: Complemental strand, 49086581 - 49086424
Alignment:
| Q |
40 |
agggacaatggaatgaaggagacgtggcttagatcgagtcgtttcaccgacatttggataaacttatagacttataaaaccaacagtttctgcattcaat |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
49086581 |
agggacaatggaatgaaggagacgtggcttagatcgggtcgtttcaccgacatttggataaacttatagacttataaaaccaacagtttctgcatgcaat |
49086482 |
T |
 |
| Q |
140 |
gaaaattggtttgctcactattgattatgtgtgtttagtatagttctacacatctttg |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
49086481 |
gaaaattggtttgctcactattgattatgtgtgtttagtatagttctacacatgtttg |
49086424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University