View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6868A_low_334 (Length: 218)
Name: NF6868A_low_334
Description: NF6868A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6868A_low_334 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 18 - 207
Target Start/End: Complemental strand, 52048337 - 52048148
Alignment:
| Q |
18 |
catcataaccatgtggaagtaacacaacgagcccggcctgacgcagccacttagactcaccacagctcaggaaattgtcaaatatgacttgagcaccatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52048337 |
catcataaccatgtggaagtaacacaacgagcccggcctgacgcagccacttagactcaccacagctcaggaaattgtcaaatatgacttgagcaccatt |
52048238 |
T |
|
| Q |
118 |
cgcaaaatcaccaaattgtgcctcccagatcaccaatgaattaggattttccattgagtaccccgattcaaatccaagaacaccaaactc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
52048237 |
cgcaaaatcaccaaattgtgcctcccagatcaccaatgaattaggattttccattgagtaccccaattcaaatccaagaacaccaaactc |
52048148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 77; Significance: 7e-36; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 18 - 198
Target Start/End: Original strand, 7770453 - 7770633
Alignment:
| Q |
18 |
catcataaccatgtggaagtaacacaacgagcccggcctgacgcagccacttagactcaccacagctcaggaaattgtcaaatatgacttgagcaccatt |
117 |
Q |
| |
|
||||||||||||| ||||| |||||||| ||||| | |||||| |||||||| | ||||||| | || ||||||||||||||| || ||||| ||||| |
|
|
| T |
7770453 |
catcataaccatgaggaagcaacacaactagcccagtctgacggagccacttggcctcaccagaagccaagaaattgtcaaatatcacatgagccccatt |
7770552 |
T |
|
| Q |
118 |
cgcaaaatcaccaaattgtgcctcccagatcaccaatgaattaggattttccattgagtaccccgattcaaatccaagaac |
198 |
Q |
| |
|
|||||||| ||||||||||| ||||| || | ||||||||| || |||||||||||||| ||| |||||||||||||||| |
|
|
| T |
7770553 |
agcaaaatctccaaattgtgcttcccaaattatcaatgaattggggttttccattgagtaacccaattcaaatccaagaac |
7770633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University