View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6868A_low_337 (Length: 216)
Name: NF6868A_low_337
Description: NF6868A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6868A_low_337 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 16 - 205
Target Start/End: Complemental strand, 43061201 - 43061012
Alignment:
| Q |
16 |
tttgaatgggtggactggtgaagttaagaatagcacggggccatggtcacaattcactatcatatgatatagtggcttatgcatatgcaacagttcttag |
115 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43061201 |
tttgaatgggtggactggtgaagttgagaatagcacggggccatggtcacaattcactatcatatgatatagtggctgatgcatatgcaacagttcttag |
43061102 |
T |
|
| Q |
116 |
attgttcttctatacattcatatatatgttgtataggtacacttttgaagtgaagcttggttagtaagcatctactgtgatgtccatctc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||| |||| ||||| |
|
|
| T |
43061101 |
attgttcttctatacattcatatatatgttgtataggtactcttttgaagtgaatcttggttagtaagcatctactgtgctgtctatctc |
43061012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University