View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6868A_low_341 (Length: 214)
Name: NF6868A_low_341
Description: NF6868A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6868A_low_341 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 63; Significance: 1e-27; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 112 - 202
Target Start/End: Original strand, 10346967 - 10347057
Alignment:
| Q |
112 |
ctatgttgattgcggatggtatggtttactagaatgaacccacctaaattctacaaaagaattattgagtcagcgaggcattgtgatgtcc |
202 |
Q |
| |
|
||||||||||||| | | ||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
10346967 |
ctatgttgattgcacaggatatggttaattagaatgaacccacctaaattctacaaaagaattattgagtcagcgaggcgttgtgatgtcc |
10347057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University