View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6868A_low_342 (Length: 213)
Name: NF6868A_low_342
Description: NF6868A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6868A_low_342 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 12 - 192
Target Start/End: Original strand, 7770453 - 7770633
Alignment:
| Q |
12 |
catcataaccatgaggaagcaacacaactagcccagtctgacggagccacttggcctcaccagaagccaagaaattgtcaaatatcacatgagccccatt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7770453 |
catcataaccatgaggaagcaacacaactagcccagtctgacggagccacttggcctcaccagaagccaagaaattgtcaaatatcacatgagccccatt |
7770552 |
T |
|
| Q |
112 |
agcaaaatctccaaattgtgcttcccaaattatcaatgaattggggttttccattgagtaacccaattcaaatccaagaac |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7770553 |
agcaaaatctccaaattgtgcttcccaaattatcaatgaattggggttttccattgagtaacccaattcaaatccaagaac |
7770633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 12 - 201
Target Start/End: Complemental strand, 52048337 - 52048148
Alignment:
| Q |
12 |
catcataaccatgaggaagcaacacaactagcccagtctgacggagccacttggcctcaccagaagccaagaaattgtcaaatatcacatgagccccatt |
111 |
Q |
| |
|
||||||||||||| ||||| |||||||| ||||| | |||||| |||||||| | ||||||| | || ||||||||||||||| || ||||| ||||| |
|
|
| T |
52048337 |
catcataaccatgtggaagtaacacaacgagcccggcctgacgcagccacttagactcaccacagctcaggaaattgtcaaatatgacttgagcaccatt |
52048238 |
T |
|
| Q |
112 |
agcaaaatctccaaattgtgcttcccaaattatcaatgaattggggttttccattgagtaacccaattcaaatccaagaacaccatactc |
201 |
Q |
| |
|
|||||||| ||||||||||| ||||| || | ||||||||| || |||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
52048237 |
cgcaaaatcaccaaattgtgcctcccagatcaccaatgaattaggattttccattgagtaccccaattcaaatccaagaacaccaaactc |
52048148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University