View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6868A_low_352 (Length: 208)
Name: NF6868A_low_352
Description: NF6868A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6868A_low_352 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 12 - 189
Target Start/End: Complemental strand, 18256615 - 18256438
Alignment:
| Q |
12 |
gatggacatcaatgtattgatcagtttcatccaatatatcttccttgaataatgaaaacaactatgtattagcaatcttatttatagaataaactgtatt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
18256615 |
gatggacatcaatgtattgatcagtttcatccaatatatcttccttgaataatgaaaacaactatgtattagcaatcttatttatagtataaattgtatt |
18256516 |
T |
|
| Q |
112 |
aacatgtgaaaatcgaattgctaattatttttataaggtgtctataatgataagaaagacaaacacagatgcgaacac |
189 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
18256515 |
aacatgggaaaatcgaattgctaattatttttataaggtgtctataatgataagaaagataaacacagatgcgaacac |
18256438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University