View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6868A_low_353 (Length: 208)
Name: NF6868A_low_353
Description: NF6868A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6868A_low_353 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 109; Significance: 5e-55; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 1 - 121
Target Start/End: Original strand, 16488784 - 16488904
Alignment:
| Q |
1 |
atccttgatattgtgtaaaattgtgttcaagtactgtgatagagccacaattgtggttgcgatgcagagaattaaaaaacctctacattgcagccgtaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||| || |
|
|
| T |
16488784 |
atccttgatattgtgtaaaattgtgttcaagtactgtgatagagccataattgtggttgcgatgcagagaattaaaaagcctctacattgcagccgttat |
16488883 |
T |
|
| Q |
101 |
ctgtttggcttggtttttctt |
121 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
16488884 |
ctgtttggcttggtttttctt |
16488904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 152 - 208
Target Start/End: Original strand, 16488899 - 16488955
Alignment:
| Q |
152 |
tttctttagtctggcagtttaaatctatgttttgctagattgccacagatctgttta |
208 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
16488899 |
tttctttagtttggcagtttaaatctatgttttgctggattgccacagatctgttta |
16488955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 65 - 207
Target Start/End: Original strand, 50514018 - 50514160
Alignment:
| Q |
65 |
cagagaattaaaaaacctctacattgcagccgtaatctgtttggcttggtttttcttaaccttaaacgatgcttctcctgggttatatttctttagtctg |
164 |
Q |
| |
|
||||| |||||||| |||| ||||||||||| | ||||| ||||||| || |||||||||||||||| ||||||||||| ||| ||||||||||||| || |
|
|
| T |
50514018 |
cagagcattaaaaagcctcgacattgcagcctttatctggttggcttcgtctttcttaaccttaaacaatgcttctcctaggtcatatttctttagtttg |
50514117 |
T |
|
| Q |
165 |
gcagtttaaatctatgttttgctagattgccacagatctgttt |
207 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||| |||||||| |
|
|
| T |
50514118 |
gcagtttaaatctttgttttgctggattgccacaaatctgttt |
50514160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University