View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6868A_low_66 (Length: 346)

Name: NF6868A_low_66
Description: NF6868A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6868A_low_66
NF6868A_low_66
[»] chr2 (1 HSPs)
chr2 (114-210)||(6915634-6915730)
[»] chr7 (2 HSPs)
chr7 (114-154)||(15041840-15041880)
chr7 (159-210)||(15040294-15040345)
[»] chr5 (1 HSPs)
chr5 (114-183)||(35856863-35856932)


Alignment Details
Target: chr2 (Bit Score: 89; Significance: 7e-43; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 114 - 210
Target Start/End: Original strand, 6915634 - 6915730
Alignment:
114 gctggtcaaatagttgctgtatttggtgttgattgtgcatccggcgatacatttactgatgggtcggttaaatacacaatgacttctatgaatgttc 210  Q
    ||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6915634 gctggccaaatagttgctgtatttggtgttgattgtgcatccagcgatacatttactgatgggtcggttaaatacacaatgacttctatgaatgttc 6915730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 37; Significance: 0.000000000008; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 114 - 154
Target Start/End: Complemental strand, 15041880 - 15041840
Alignment:
114 gctggtcaaatagttgctgtatttggtgttgattgtgcatc 154  Q
    ||||| |||||||||||||||||||||||||||||||||||    
15041880 gctggccaaatagttgctgtatttggtgttgattgtgcatc 15041840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 159 - 210
Target Start/End: Complemental strand, 15040345 - 15040294
Alignment:
159 gatacatttactgatgggtcggttaaatacacaatgacttctatgaatgttc 210  Q
    ||||| |||||||||||||| |||||||| ||||||||||| |||| |||||    
15040345 gatacttttactgatgggtctgttaaatatacaatgacttcaatgagtgttc 15040294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 114 - 183
Target Start/End: Original strand, 35856863 - 35856932
Alignment:
114 gctggtcaaatagttgctgtatttggtgttgattgtgcatccggcgatacatttactgatgggtcggtta 183  Q
    ||||| ||||| |||| ||||| || ||||||||||||| | || || ||||||||||||||||| ||||    
35856863 gctggacaaattgttgttgtatgtgatgttgattgtgcaccaggagaaacatttactgatgggtctgtta 35856932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University