View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6868A_low_67 (Length: 345)
Name: NF6868A_low_67
Description: NF6868A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6868A_low_67 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 6 - 345
Target Start/End: Complemental strand, 55412443 - 55412098
Alignment:
| Q |
6 |
aaagagatggggggttgcggtagttctctgttggagctgaggcgtatcctcccacatgggtggatgtctgacttggaagacaaagctcgcagcatgctga |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
55412443 |
aaagagatggggggttgcggtagttctctgttggagctgaggcgtatcctcccacatgggtggatgtctgacttggaagacaaagctcgcagtatgctga |
55412344 |
T |
|
| Q |
106 |
aaatttgggaaattaaacaaactactcttcagcatgaagaagctgtatcgagctatggttcagaatcaaaaagcagtttaaaagaagggatgttgctctt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55412343 |
aaatttgggaaattaaacaaactactcttcagcatgaagaagctgtatcgagctatggttcagaatcaaaaagcagtttaaaagaagggatgttgctctt |
55412244 |
T |
|
| Q |
206 |
ccgaaaacattggacaaatggtgaaccaattattgttcgtgatgttctaaaacatgggacaggtctgagctgggagccgatggtcatgtggcgagcattg |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55412243 |
ccgaaaacattggacaaatggtgaaccaattattgttcgtgatgttctaaaacatgggacaggtctgagctgggagccgatggtcatgtggcgagcattg |
55412144 |
T |
|
| Q |
306 |
tgtgataatgtggcttcaga------ttcaaaaatgtcagaagtga |
345 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
55412143 |
tgtgataatttggcttcagatatcagttcaaaaatgtcagaagtga |
55412098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University