View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6868A_low_70 (Length: 335)
Name: NF6868A_low_70
Description: NF6868A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6868A_low_70 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 3 - 331
Target Start/End: Complemental strand, 36269016 - 36268687
Alignment:
| Q |
3 |
tgcaggaaaggggggaagttgtgtgtagggaggggaggtgggtcagtgcgttggcagactgtgaataatattagagagggtgttgggctaatagattgag |
102 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
36269016 |
tgcaggaaagggggaaagttgtgtgtagggaggggaggtgggtcagtgtgttggcatactgtgaataatattagagagggtgttgcgctagtagattgag |
36268917 |
T |
|
| Q |
103 |
gtcgactgcttgataatatttgtcggaaggttggggatgagtcttctactctgttttggaatgatccttggttggatggtagatctttgaaagatagttt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| |||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36268916 |
gtcgactgcttgataatatttgtcggaaggttggtgatgagtcttctactttgttttgaaatgatccttggttggatcgtagatctttgaaagatagttt |
36268817 |
T |
|
| Q |
203 |
tagaagtttgtttgagttagctgataacaaattggcaacagtcgcggagatgttttctttgggttggggagtgaatgacgaggcct-gaagtagcgtatg |
301 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
36268816 |
tagaagtttgtttcagttagctgataacaaattggcaacggtcgcggaaatgttttctttgggttggggagtgaatgacgaggcttaaaagtagcgtatg |
36268717 |
T |
|
| Q |
302 |
aggttgcttgaaagtagcagtcaataatca |
331 |
Q |
| |
|
||||||||||||||||||| |||||||||| |
|
|
| T |
36268716 |
aggttgcttgaaagtagcaatcaataatca |
36268687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University