View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6868A_low_78 (Length: 323)
Name: NF6868A_low_78
Description: NF6868A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6868A_low_78 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 72; Significance: 1e-32; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 112 - 187
Target Start/End: Original strand, 6915655 - 6915730
Alignment:
| Q |
112 |
tttggtgttgattgtgcatccggcgatacatttactgatgggtcggttaaatacacaatgacttctatgaatgttc |
187 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6915655 |
tttggtgttgattgtgcatccagcgatacatttactgatgggtcggttaaatacacaatgacttctatgaatgttc |
6915730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 136 - 187
Target Start/End: Complemental strand, 15040345 - 15040294
Alignment:
| Q |
136 |
gatacatttactgatgggtcggttaaatacacaatgacttctatgaatgttc |
187 |
Q |
| |
|
||||| |||||||||||||| |||||||| ||||||||||| |||| ||||| |
|
|
| T |
15040345 |
gatacttttactgatgggtctgttaaatatacaatgacttcaatgagtgttc |
15040294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University