View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6869A_low_121 (Length: 233)
Name: NF6869A_low_121
Description: NF6869A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6869A_low_121 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 11 - 205
Target Start/End: Complemental strand, 23193428 - 23193234
Alignment:
| Q |
11 |
tgagatggacatcagtagagttgcacaaattatgaagagctggttgttgccaaacaggatggcattcaacttggttaactgctggcggaatcttagcata |
110 |
Q |
| |
|
||||||| ||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23193428 |
tgagatgaacaccagtagaattgcacaaattatgaagagctggttgttgccaaacaggatggcattcaacttggttaactgctggcggaatcttagcata |
23193329 |
T |
|
| Q |
111 |
tccgagtaagtcttgaagcttcttagttgaaaagttgctgacatcaatcgcacgtgcttgacctgaggagaataaaccttccattgcattccatg |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
23193328 |
tccgagtaagtcttgaagcttcttagttgaaaagttgctgacaccaatcgcacgtgcttgacctgaggcgaataaaccttccattgcattccatg |
23193234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University