View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6869A_low_123 (Length: 232)
Name: NF6869A_low_123
Description: NF6869A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6869A_low_123 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 133
Target Start/End: Complemental strand, 37169189 - 37169057
Alignment:
| Q |
1 |
aagtggcacgttttgacaggaccactgtagatacaatgacataacagaaattggtttgagaccagaatgggtgttggaaatagaaagttggattatggat |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
37169189 |
aagtggcacgttttgacaggatcactgtagatacaatgacataacagaaattggtttgagatcagaatgggtgttggaaatggaaagttggattatggat |
37169090 |
T |
 |
| Q |
101 |
gagggaggtttctggtggtgcgggtgatgaatg |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
37169089 |
gagggaggtttctggtggtgcgggtgatgaatg |
37169057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 133 - 223
Target Start/End: Complemental strand, 37168985 - 37168895
Alignment:
| Q |
133 |
gttaagatcatttaactatattaaacttgatgtgtaatttggaccgtcttttctacaacaacaaatcaaaatcctatatgtgtatattgtt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37168985 |
gttaagatcatttaactatattaaacttgatgtgtaatttggaccgtcttttctacaacaacaaatcaaaatcctatatgtgtatattgtt |
37168895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University