View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6869A_low_131 (Length: 230)
Name: NF6869A_low_131
Description: NF6869A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6869A_low_131 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 28 - 187
Target Start/End: Complemental strand, 37809249 - 37809090
Alignment:
| Q |
28 |
ttattcaggtacatggaaccattgatttccagtgtccctgtaatggtagtagaagggaatcatgagatggaagaacaagctgaaaacaagacattcgttg |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
37809249 |
ttattcaggtacatggaaccattgatttccagtgtcccggtaatggtagtagaagggaatcatgagatagaagaacaagctgaaaacaagacattcgttg |
37809150 |
T |
|
| Q |
128 |
cttatagttctcgatttgcatttccgtcggaagagagtggatcatcttcaactttatatt |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37809149 |
cttatagttctcgatttgcatttccgtcggaagagagtgggtcatcttcaactttatatt |
37809090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 30 - 187
Target Start/End: Complemental strand, 37816661 - 37816504
Alignment:
| Q |
30 |
attcaggtacatggaaccattgatttccagtgtccctgtaatggtagtagaagggaatcatgagatggaagaacaagctgaaaacaagacattcgttgct |
129 |
Q |
| |
|
|||||||||||||||||| ||||| | |||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37816661 |
attcaggtacatggaacctctgattgctagtgtcccaataatggtagtggaagggaatcatgagatagaagaacaagctgaaaacaagacattcgttgct |
37816562 |
T |
|
| Q |
130 |
tatagttctcgatttgcatttccgtcggaagagagtggatcatcttcaactttatatt |
187 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| || ||||| |||| |
|
|
| T |
37816561 |
tatagttctcgatttgcatttccgtcagaagagagtggatcatcatccactttctatt |
37816504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University