View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6869A_low_144 (Length: 224)
Name: NF6869A_low_144
Description: NF6869A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6869A_low_144 |
 | |
|
| [»] scaffold0189 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0189 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: scaffold0189
Description:
Target: scaffold0189; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 25 - 206
Target Start/End: Original strand, 30594 - 30775
Alignment:
| Q |
25 |
gttcttatttcatgtttttgtgttatgacctataattttttgacttgaaaattacttgggtgtcttttggtttttgtgtgtaaatagtagtagagctgga |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30594 |
gttcttatttcatgtttttgtgttatgacctataattttttgacttgaaaattacttgggtgtcttttggtttttgtgtttaaatagtagtagagctgga |
30693 |
T |
|
| Q |
125 |
aataaacacataggtggtgtttgtattttatagttcaaataacacaactgcatgtgtgttaatttcaggtgtattttgatgt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
30694 |
aataaacacataggtggtgtttgtattttatagttcaaataacacaactgcatgtgtgttaattacaggtgtattttgatgt |
30775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University