View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6869A_low_151 (Length: 219)
Name: NF6869A_low_151
Description: NF6869A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6869A_low_151 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 29 - 219
Target Start/End: Original strand, 46894221 - 46894410
Alignment:
| Q |
29 |
atctaaaaataccacaaccccgtcaactaattgcctctctttaatgaaaaccagttggatgggagaaattatcttatacaaaccttggcaacaaacttgt |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46894221 |
atctaaaaataccacaaccccgtcaactaattgcctctctttaatgaaagccagttggatgggagaaattatcttatacaaaccttggcaacaaacttgt |
46894320 |
T |
|
| Q |
129 |
acaaccaccccaagaaggaagatcgacctaaaatccccaagacgaagaggacagtccatcttatgaattaacaaagaatgaagcgaagcta |
219 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
46894321 |
acaacca-cccaagaaggaagatcgacctaaaatccccaagacgaagaggacagtccatcttatgaattaacaaagaatgaagggaagcta |
46894410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University