View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6869A_low_158 (Length: 210)
Name: NF6869A_low_158
Description: NF6869A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6869A_low_158 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 19 - 197
Target Start/End: Original strand, 14805036 - 14805215
Alignment:
| Q |
19 |
aacataaacaattgcaaatcaaataatatcaaatcatactttacatgacagtataatgaaatagttaaacgaaactataccaattttctcttttgagcag |
118 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14805036 |
aacataaacaattacaaatcaaataatatcaaatcatactttacatgacagtataatgaaatagttaaacgaaactataccaattttctcttttgagcag |
14805135 |
T |
|
| Q |
119 |
atatgcctcttagcttcaaatcaaaacatatggttgttc-tttgttgttacatctgctatgaaaagttggatattcttcg |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14805136 |
atatgcctcttagcttcaaatcaaaacatatggttgttcttttgttgttacatctgctatgaaaagttggatattcttcg |
14805215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University