View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6869A_low_29 (Length: 350)
Name: NF6869A_low_29
Description: NF6869A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6869A_low_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 1 - 301
Target Start/End: Original strand, 401769 - 402069
Alignment:
| Q |
1 |
tcacagccctctcccattccagcacaacagccacatcccatagccataggcgctatattggcaagacttcagaggtttgttccacctgaaagggttcgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
401769 |
tcacagccctctcccattccagcacaacagccacatcccatagccataggcgctatattggcaagacttcagaggtttgttccatctgaaagggttcgaa |
401868 |
T |
 |
| Q |
101 |
gattgagacctataatgtttcgttgaatgaaatctccgaaaaccagcaaatatttattctggcatctcataaatacaatctcgattttattcccagttaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
401869 |
gattgagacctataatgtttcgttgaatgaaatctccgaaaaccagcaaatatttattctggcatctcataaatacaatctcgattttatccacagttaa |
401968 |
T |
 |
| Q |
201 |
accagccggcttcaagcaattgagagagnnnnnnnnngtcttccaacacccttcaaacacagaaaccaattgtttgggttagcagcctcccagcacgcca |
300 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
401969 |
accagccggcttcaagcaattgagagagttttttttggtcttccaacacccttcaaacacagaaaccaattgtttgggttagcagcctcccagcacacca |
402068 |
T |
 |
| Q |
301 |
t |
301 |
Q |
| |
|
| |
|
|
| T |
402069 |
t |
402069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University