View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6869A_low_34 (Length: 334)
Name: NF6869A_low_34
Description: NF6869A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6869A_low_34 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 1 - 334
Target Start/End: Original strand, 2162959 - 2163290
Alignment:
| Q |
1 |
gtagttcttttcctttgactctagaactttgggattgaattaccggtgtatcagtgttttcttttttactgtgaatttgagagcaaaacacatagcccca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
2162959 |
gtagttcttttcctttgactctagaactttgggattgaattaccggtgtatcagtgttttcttttttactgtgaatgtgagagtaaaacacatagcccca |
2163058 |
T |
 |
| Q |
101 |
gttaaatcatatattttatttgtgaggacagagtcagtagcggagtggctgttctgaaaagaatttaggttatttctttataaaaagtggtgttagattt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2163059 |
gttaaatcatatattttatttgtgaggacagagtcagtagtggagtggctgttctgaaaagaatttaggttatttctttataaaaagcggtgttagattt |
2163158 |
T |
 |
| Q |
201 |
tgatgtcactttttaactattaactggtcttttataactttcgatagtgtatcttgggtcttttcctatagtattccgttgtagatttgccttgcactca |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2163159 |
tgatgtcactttttaactattaactggtcttt--taactttctatagtgtatcttgggtcttttcctattgtattccgttgtagatttgccttgcactca |
2163256 |
T |
 |
| Q |
301 |
atatatggcatgcaatctgtatctggtccctgat |
334 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||| |
|
|
| T |
2163257 |
atatatgacatgcaatctgtgtctggtccctgat |
2163290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University