View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6869A_low_38 (Length: 318)
Name: NF6869A_low_38
Description: NF6869A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6869A_low_38 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 16 - 302
Target Start/End: Complemental strand, 5950916 - 5950630
Alignment:
| Q |
16 |
tggacatcacaaattgggatccttctgaaattgctactatgattgaagcagagatatcaatgctacttccagataggacgaacagttatccagacgacga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
5950916 |
tggacatcacaaattgggatccttctgaaattgctactatgattgaagcagagatatcaatgctacttccagataggacgaacagttatcaagacgacga |
5950817 |
T |
 |
| Q |
116 |
gaataatgcaagtcctcgtcgttatcatcattttccctctgtctcttctgtttcatcgtcacaagaatcattgtcgggtgcagtcaatagagctgatgac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5950816 |
gaataatgcaagtcctcgtcgttatcatcattttccctctgtctcttctgtttcatcgtcacaagaatcattgtcgggtgcagtcaatagagttgatgac |
5950717 |
T |
 |
| Q |
216 |
atatcaaatggatatcgctggcaccatggtacgtcttctttttcccttcacaagctatgttgtggatgtcctatttcaatgatgtcc |
302 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5950716 |
atatcaaatggatatcgctggcaccctggtacgtcttctttttcccttcacaagctatgttgtggatgtcctatttcaatgatgtcc |
5950630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University