View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6869A_low_49 (Length: 291)
Name: NF6869A_low_49
Description: NF6869A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6869A_low_49 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 60 - 196
Target Start/End: Original strand, 15827214 - 15827348
Alignment:
| Q |
60 |
tttaggtgatctatgattgcatttgagataagactatacctttttacttgacacttgatatgcctcaatacttctgctgatagacaagctagactattgt |
159 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
15827214 |
tttaggtgatctatgattgcatt-gagataagactatacctttttacttgacacctgatatgcctcaatacttctgctgatagacaagctagactcttgt |
15827312 |
T |
|
| Q |
160 |
gatttcttcatgaaattgttaaagcatatgagtcaag |
196 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |
|
|
| T |
15827313 |
gatttcttcatgaaattgtt-aagcatatgagtcaag |
15827348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 189 - 291
Target Start/End: Original strand, 15827495 - 15827597
Alignment:
| Q |
189 |
gagtcaagtgtatggtttctctcataaaaaatttcattttgaacattgggatatgactcgcaagtggaatttcttatgatataaccaacattttgtattt |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
15827495 |
gagtcaagtgtatggtttctctcataaaaaatttcattttgaacattgggatatgactcgcaagtggaatttctcatgatataaccaacattttgtattt |
15827594 |
T |
|
| Q |
289 |
tga |
291 |
Q |
| |
|
||| |
|
|
| T |
15827595 |
tga |
15827597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 51 - 108
Target Start/End: Complemental strand, 5600674 - 5600618
Alignment:
| Q |
51 |
tcttctctttttaggtgatctatgattgcatttgagataagactatacctttttactt |
108 |
Q |
| |
|
||||||||||||||||||||||||||| || ||||||| ||||| || ||||||||| |
|
|
| T |
5600674 |
tcttctctttttaggtgatctatgattaca-ttgagatgagactctatgtttttactt |
5600618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University