View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6869A_low_61 (Length: 269)
Name: NF6869A_low_61
Description: NF6869A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6869A_low_61 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 4e-87; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 8 - 201
Target Start/End: Complemental strand, 13879887 - 13879696
Alignment:
| Q |
8 |
ccaagaaaatctcactctgtcaactgtcaacacaatggcattttcccgcctcctttcttcctcttaccactctttcatgtccgccgtgcctgcattcatt |
107 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13879887 |
ccaagaaaatctcact--gtcaactgttaacacaatggcattttcccgcctcctttcttcctcttaccactctttcatgtccgccgtgcctgcattcatt |
13879790 |
T |
|
| Q |
108 |
cgccaccgccccttcgctactgccgccatgtctctggttgccatctcctacgctgctcctcgactcattcactatttcaacaccaatgagctga |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
13879789 |
cgccaccgccccttcgctactgccgccatgtctctggttgccatctcctacgccactccacgactcattcgctatttcaacaccaatgagctga |
13879696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 34 - 197
Target Start/End: Complemental strand, 13875640 - 13875477
Alignment:
| Q |
34 |
tcaacacaatggcattttcccgcctcctttcttcctcttaccactctttcatgtccgccgtgcctgcattcattcgccaccgccccttcgctactgccgc |
133 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |||| ||| |||||| ||||||||||| || ||||||||| || |||| ||||||||||||| |
|
|
| T |
13875640 |
tcaacacaatggcattttcccgcctcctctcttcctgctaccgctcattcatggccgccgtgccttcactcattcgccgccaccccgtcgctactgccgc |
13875541 |
T |
|
| Q |
134 |
catgtctctggttgccatctcctacgctgctcctcgactcattcactatttcaacaccaatgag |
197 |
Q |
| |
|
|||||| || || |||||||||||| | || |||| |||||||| ||||||||||||||||||| |
|
|
| T |
13875540 |
catgtcactcgtagccatctcctacaccgcacctccactcattcgctatttcaacaccaatgag |
13875477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 225 - 269
Target Start/End: Complemental strand, 13879675 - 13879631
Alignment:
| Q |
225 |
gatgatgatgatcttgttctctgggattttacggagactgaggag |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13879675 |
gatgatgatgatcttgttctctgggattttacggagactgaggag |
13879631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 34 - 70
Target Start/End: Complemental strand, 13885756 - 13885720
Alignment:
| Q |
34 |
tcaacacaatggcattttcccgcctcctttcttcctc |
70 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
13885756 |
tcaacacaatggcattttcccgcttcctctcttcctc |
13885720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University