View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6869A_low_78 (Length: 254)
Name: NF6869A_low_78
Description: NF6869A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6869A_low_78 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 47802703 - 47802938
Alignment:
| Q |
1 |
ataaattatggcaggattatgaatttgccttgagcacaattcataggctggaccatgagatcacttcatatgattttactacttcaaaagaataattatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47802703 |
ataaattatggcaggattatgaatttgccttgagcacaattcataggctggaccatgagatcacttcatatgattttactacttcaaaagaataattatg |
47802802 |
T |
 |
| Q |
101 |
aaactagttgttccagaatagtgcccaaacgcacaatatatgtagtattatagaggcttcaaatctggtcatatcaaatacactaaaagtaaaatatgat |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47802803 |
aaactagttgttccagaatagtgctcaaacgcacaatatatgtagtattatagatgcttcaaatctggtcatatcaaatacactaaaagtaaaatatgat |
47802902 |
T |
 |
| Q |
201 |
gaaacacttgtattaaaaatgtttgatgcattgatg |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |
|
|
| T |
47802903 |
gaaacacttgtattaaaaatgtttgatgcactgatg |
47802938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 36 - 137
Target Start/End: Original strand, 47797032 - 47797133
Alignment:
| Q |
36 |
acaattcataggctggaccatgagatcacttcatatgattttactacttcaaaagaataattatgaaactagttgttccagaatagtgcccaaacgcaca |
135 |
Q |
| |
|
|||||||||||||||||||| || |||| ||||||||||||||||||| |||| |||||||| |||||||||||||| |||||||||| ||| | |||| |
|
|
| T |
47797032 |
acaattcataggctggaccaagacatcatttcatatgattttactactcaaaaacaataattacgaaactagttgttcaagaatagtgctcaagcacaca |
47797131 |
T |
 |
| Q |
136 |
at |
137 |
Q |
| |
|
|| |
|
|
| T |
47797132 |
at |
47797133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University