View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6869A_low_80 (Length: 253)
Name: NF6869A_low_80
Description: NF6869A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6869A_low_80 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 45123343 - 45123582
Alignment:
| Q |
1 |
attattttctagttgttattggacaatgatcatagtttcgtctccgctttttgaagtttccacctatgttgtgattgtgtttctttattttctctatgtt |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45123343 |
attattttctagttgtcattggacaatgatcatagtttcgtctccgctttttgaagtttctacctatgttgtgattgtgtttctttattttctctatgtt |
45123442 |
T |
|
| Q |
101 |
gatcttttccaacacaattttgtcttcaactatgaaaaatgtttctcaaatgtatccttctatgaatgtctattacagaatattatgaatattagtgatg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
45123443 |
gatcttttccaacacaattttgtcttcaactatgaaaaatgtttctcaaatatatccttctatgaatgtctattacaaaatattatgaatattagtgatg |
45123542 |
T |
|
| Q |
201 |
atgtattgattaaatgtatttttaacggtcttcatatcag |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45123543 |
atgtattgattaaatgtatttttaacggtcttcatctcag |
45123582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University