View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6869A_low_88 (Length: 249)
Name: NF6869A_low_88
Description: NF6869A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6869A_low_88 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 13 - 249
Target Start/End: Complemental strand, 37169408 - 37169172
Alignment:
| Q |
13 |
atggacatcaaataattatagggnnnnnnngaaaggataggatgaagcgtgaggtgcaggattatggaggatgaccatacattgaaattatttaacacat |
112 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
37169408 |
atggacatcaaataattatagggaaaaaatgaaaggataggatgaagcgtgaggtgcaggattatggaggatgacaatacattgaaattatttaacacat |
37169309 |
T |
 |
| Q |
113 |
ggacttatgtttgcaaagaaaagctcaataactccacaggttcgagtattatgtagcatcttcttccactgtttgcttcccaggcgtgatcaactatgtc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37169308 |
ggacttatgtttgcaaagaaaagctcaataactccacaggttcgagtattatgtagcatcttcttccactgtttgcttcccaggcgtgatcaactatgtc |
37169209 |
T |
 |
| Q |
213 |
tattcgtgcatggccgcacaagtggcacgttttgaca |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37169208 |
tattcgtgcatggccgcacaagtggcacgttttgaca |
37169172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University