View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6870A_high_21 (Length: 295)
Name: NF6870A_high_21
Description: NF6870A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6870A_high_21 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 51; Significance: 3e-20; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 93 - 215
Target Start/End: Original strand, 10010331 - 10010449
Alignment:
| Q |
93 |
cttacaatttttattattgttgggaaagaacattttagtgtctctttcaccctttttctgcaacattgtagagccacnnnnnnnnnnnnttgttttgtac |
192 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||| ||| |||| || ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
10010331 |
cttacaatttttactattattgggaaagaacattttagtg--tctgtcactctctttctgcaacattgtagagccac--acaaaaaaaattgttttgtac |
10010426 |
T |
|
| Q |
193 |
aaattagtacattggtatgcacc |
215 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
10010427 |
aaattagtacattggtatgcacc |
10010449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 10010287 - 10010337
Alignment:
| Q |
19 |
atatcatactctttatatagcatagcacattcttccactttcataacttacaa |
71 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10010287 |
atatcatactct--atatagcatagcacattcttccactttcataacttacaa |
10010337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University