View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6870A_low_112 (Length: 208)
Name: NF6870A_low_112
Description: NF6870A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6870A_low_112 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 52; Significance: 5e-21; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 81 - 132
Target Start/End: Complemental strand, 43285481 - 43285430
Alignment:
| Q |
81 |
catgccttggtgtcagatatacccacgtgaggcctcactgccacccccatgt |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43285481 |
catgccttggtgtcagatatacccacgtgaggcctcactgccacccccatgt |
43285430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University