View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6870A_low_31 (Length: 320)
Name: NF6870A_low_31
Description: NF6870A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6870A_low_31 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 148 - 279
Target Start/End: Complemental strand, 38930295 - 38930164
Alignment:
| Q |
148 |
taaataagagttctgcttttgataaaaatgtttagttccacatacttgagaggatttgtatactctatcgatgctttaagattttggtgaaaatgtgttg |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
38930295 |
taaataagagttctgcttttgataaaaatgtttagttccacatgcttgagaggattcgtatactctatcgatactttaagattttggtgaaaatgtgttg |
38930196 |
T |
|
| Q |
248 |
tccaatcatttattagtgtcactgttgctata |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
38930195 |
tccaatcatttattagtgtcactgttgctata |
38930164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 18 - 146
Target Start/End: Complemental strand, 38930797 - 38930669
Alignment:
| Q |
18 |
catcaaggttaaggttgtatactaagcctatattannnnnnnnaacaaaccaaaataaaatatattaaccacacaaatgttctcctatgcacaagaagtg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38930797 |
catcaaggttaaggttgtatactaagcctatatttttttttttaataaaccaaaataaaatatattaaccacacaaatgttctcctatgcacaagaagtg |
38930698 |
T |
|
| Q |
118 |
tgtacataaagaacaaagtattaattaca |
146 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
38930697 |
tgtacataaagaacaaagtattaattaca |
38930669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University