View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6870A_low_87 (Length: 226)
Name: NF6870A_low_87
Description: NF6870A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6870A_low_87 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 20 - 205
Target Start/End: Complemental strand, 13292823 - 13292638
Alignment:
| Q |
20 |
accagtgttgtttgttactatgtaataaagtcaatattaaatggatttaacttaatgtttaaaacacaaacaatacgtcaacaatgcatgcatttggaac |
119 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
13292823 |
accagtgttgtttgttactatgtaacaaagtcaaaattaaatggatttaacttaatgtttaaaacacaaacaatacgtaaacaatgcatacatttggaac |
13292724 |
T |
|
| Q |
120 |
ctcaaattggaagatatcatgattttgttgagagaaattaaacaatattcaatatatgcacataactgacgaaaaagcagaagaaa |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||| |||||||||||| |
|
|
| T |
13292723 |
ctcaaattggaagatatcatgattttgttgagagaaattaaacaatattcaatacatgcacatatctgacgaagaagcagaagaaa |
13292638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University