View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6871A_low_105 (Length: 260)
Name: NF6871A_low_105
Description: NF6871A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6871A_low_105 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 9e-79; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 9e-79
Query Start/End: Original strand, 9 - 157
Target Start/End: Complemental strand, 55848878 - 55848730
Alignment:
| Q |
9 |
gaaatgaaatgtgactgggcaaagatattgacatccgaaaagtactctggggtgttcgcaggcagaacagctgatgagttgagggtaaagtattctctaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55848878 |
gaaatgaaatgtgactgggcaaagatattgacatccgaaaagtactctggggtgttcgcaggcagaacagctgatgagttgagggtaaagtattctctaa |
55848779 |
T |
|
| Q |
109 |
aactaaatagcctaatctttgtattgtatattaattgtcttcaaattgc |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55848778 |
aactaaatagcctaatctttgtattgtatattaattgtcttcaaattgc |
55848730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 57 - 157
Target Start/End: Complemental strand, 55784648 - 55784548
Alignment:
| Q |
57 |
ggggtgttcgcaggcagaacagctgatgagttgagggtaaagtattctctaaaactaaatagcctaatctttgtattgtatattaattgtcttcaaattg |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55784648 |
ggggtgttcgcaggcagaacagctgatgagttgagggtaaagtattctctaaaactaaatagcctaatctttgtattgtatattaattgtcttcaaattg |
55784549 |
T |
|
| Q |
157 |
c |
157 |
Q |
| |
|
| |
|
|
| T |
55784548 |
c |
55784548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 232 - 260
Target Start/End: Complemental strand, 55784473 - 55784445
Alignment:
| Q |
232 |
gatggaaggaagctcgagagattgcatga |
260 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
55784473 |
gatggaaggaagctcgagagattgcatga |
55784445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 232 - 260
Target Start/End: Complemental strand, 55848655 - 55848627
Alignment:
| Q |
232 |
gatggaaggaagctcgagagattgcatga |
260 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
55848655 |
gatggaaggaagctcgagagattgcatga |
55848627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University