View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6871A_low_112 (Length: 253)
Name: NF6871A_low_112
Description: NF6871A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6871A_low_112 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 14721991 - 14722044
Alignment:
| Q |
1 |
tcaacatttttgctaaccccactaaatttgaccatctatgaacatcactttaca |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14721991 |
tcaacatttttgctaaccccactaaatttgaccatctatgaacatcactttaca |
14722044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 2 - 54
Target Start/End: Complemental strand, 39465259 - 39465207
Alignment:
| Q |
2 |
caacatttttgctaaccccactaaatttgaccatctatgaacatcactttaca |
54 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||| ||||||||| |||||||| |
|
|
| T |
39465259 |
caacatttttgctaactccactaaatctgaccatatatgaacattactttaca |
39465207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University