View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6871A_low_134 (Length: 249)
Name: NF6871A_low_134
Description: NF6871A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6871A_low_134 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 11 - 230
Target Start/End: Complemental strand, 32268287 - 32268068
Alignment:
| Q |
11 |
agaatatgattcggtaatctatagttcaataataatgattgaaaaattattttttcggcgaagaattgaacgtgtgttgttctgaacaatctgtcttaaa |
110 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32268287 |
agaaaatgatttggtaatctatagttcaataataatgattgaaaaatgattttttcggcgaagaattgaacgtgtgttgttctgaacaatttgtcttaaa |
32268188 |
T |
 |
| Q |
111 |
ataaaacacattaaccacttcaactaaatctcgtattttgaaagaagggaataataaccttttaatgctggttgttttacaaatagagatggacgaaaaa |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32268187 |
ataaaacacattaaccacttcaactaaatctcgtattttgaaagaagagaataataaccttttaatgctggttgttttacaaatagagatggacgaaaaa |
32268088 |
T |
 |
| Q |
211 |
gttgctactttgttgaattt |
230 |
Q |
| |
|
||||| |||||||||||||| |
|
|
| T |
32268087 |
gttgcaactttgttgaattt |
32268068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University