View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6871A_low_17 (Length: 416)
Name: NF6871A_low_17
Description: NF6871A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6871A_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 262
Target Start/End: Complemental strand, 9868082 - 9867821
Alignment:
| Q |
1 |
aatataccacacacatcaaaccctatccttaattcaacatacaaaaattgctttggaacattggtgaaatataaagaagcgacgccagtctctctttgat |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
9868082 |
aatataccacacacatcaaaccctttccttaattcaacatacaaaaattgctttggaacattggtgaaatataaggaagcgacgccagtctctctttgat |
9867983 |
T |
|
| Q |
101 |
catgatttcgtcatgcatcgtgaatatgatgattgagtcatatttgtttagccatgcatgactaaattccacgtgaataaaacttttctagacagtgtga |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
9867982 |
catgatttcgccatgcatcgtgaatatgatgattgaatcatatttgtttagccatgcatgactaaattccacgttaataaaacttttctagatggtgtga |
9867883 |
T |
|
| Q |
201 |
tccaattaccactaagaccgctactaaaggcaaaccacaaccgcctagtcttttgcgaatgt |
262 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
9867882 |
tccaattaccactacgatcgctactaaaggcaaaccacagtcgactagtcttttgcgaatgt |
9867821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 259 - 359
Target Start/End: Complemental strand, 9867765 - 9867665
Alignment:
| Q |
259 |
atgttgaagtccccaaccctttgattactgttgattnnnnnnnttgccgcgagaaactctgaaacttggcatgtcgtcgatcatccccccatgacccata |
358 |
Q |
| |
|
||||||||||| |||||||||||| ||| |||||| |||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
9867765 |
atgttgaagtcttcaaccctttgatgactattgattctcccccttgccgcgagaaactctgaaacttggcatgtcctcgatcatcctcccatgacccata |
9867666 |
T |
|
| Q |
359 |
t |
359 |
Q |
| |
|
| |
|
|
| T |
9867665 |
t |
9867665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University