View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6871A_low_201 (Length: 227)
Name: NF6871A_low_201
Description: NF6871A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6871A_low_201 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 43410787 - 43411010
Alignment:
| Q |
1 |
tttggatgatgaaggagaaggggttgtgttatcatgtgatgctgatcttaaagaatgtaaagacttgcacacatcatctcacacacgtaccattagactc |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43410787 |
tttggatgatgaaggagaatgggttgtgttatcatgtgatgctgatcttgaagaatgtaaagacttgcacacatcatctcacacacgtaccattagactc |
43410886 |
T |
 |
| Q |
101 |
tctctttttcaagcttcccctctcaatcttccaaacactttccgcaacagcagcagcagcagtccatcctc----ctagctagcttacaacttc---tca |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| |
|
|
| T |
43410887 |
tctctttttcaagcttcccctctcaatcttccaaacactttccgcaacagcagcagcagcagtccatcctcctagctagctagcttacaacttctgatca |
43410986 |
T |
 |
| Q |
194 |
tctgaatgtgttgtgtctgtctgt |
217 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
43410987 |
tctgaatgtgttgtgtctgtctgt |
43411010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University