View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6871A_low_205 (Length: 226)
Name: NF6871A_low_205
Description: NF6871A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6871A_low_205 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 3 - 204
Target Start/End: Original strand, 46421140 - 46421340
Alignment:
| Q |
3 |
ttccaatgagatggacatcaaatagcggtctgcaaagatgaagttctgccaagagacagccgacagaaaatttgtcccttgcaatatcttcagaggcaag |
102 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
46421140 |
ttccaatgagattga-atcaaatagcggtctgcaaagatgaagttctgccaagagacagccgacagaaaatatgtcccttgcaatatcttcagaggcaag |
46421238 |
T |
|
| Q |
103 |
tcttgaagaagacaatttctgcctccagagaagcaagtccggatatcctgaaaagccttcatcttcctctttcatatgttgaagaaaagatatatggttc |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46421239 |
tcttgaagaagacaatttctgcctccagagaagcaagtctggatatcctgaaaagccttcatcttcctctttcatatgttgaagaaaagatatatggttc |
46421338 |
T |
|
| Q |
203 |
at |
204 |
Q |
| |
|
|| |
|
|
| T |
46421339 |
at |
46421340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University