View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6871A_low_206 (Length: 226)
Name: NF6871A_low_206
Description: NF6871A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6871A_low_206 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 5 - 220
Target Start/End: Original strand, 1329871 - 1330086
Alignment:
| Q |
5 |
gagagtgcagattgggaaacagcgttggtacaatcaaccagccacttaggaaaccagcagcctgcattaggtggaggctttgatacattattgttggatg |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1329871 |
gagagtgcagattgggaaacagcgttggtacaatcaaccagccacttaggaaaccagcagcctgcattaggtggaggctttgatacattattgttggatg |
1329970 |
T |
 |
| Q |
105 |
gtatgtataaacaaggagaaatgaatgcagccatgcaaggagtgggatatggttgcagtggaagtgctagcagtgtagcacttggttcagccggaaggcc |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1329971 |
gtatgtataaacaaggagaaatgaatgcagccatgcaaggagtgggatatggtggcagtggaagtgctagcagtgtagcacttggttcagccggaaggcc |
1330070 |
T |
 |
| Q |
205 |
agcaatgctagcattg |
220 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
1330071 |
agcaatgctagcattg |
1330086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University