View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6871A_low_213 (Length: 222)
Name: NF6871A_low_213
Description: NF6871A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6871A_low_213 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 6 - 222
Target Start/End: Original strand, 41102900 - 41103116
Alignment:
| Q |
6 |
atctccgacggtggattatcctcgtcgtgaattggacttttgtagtaagattccggtaccggagtttgtggccaatcggaaactatatcgccgattgctt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41102900 |
atctccgacggtggattatcctcgtcgtgaattggacttttgtagtaagattccggtaccggagtttgtggccaatcggaaactatatcgccgattgctt |
41102999 |
T |
|
| Q |
106 |
cgctgtaatcggcgagaagtgcgatgtagttcatgacatagcgtgtgagaggatggattcctccgcctggtaccggaatcttcgaagattccttctgaat |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41103000 |
cgctgtaatcggcgagaagtgcgatgtagttcatgacatagcgtgtgagaggatggattcctccgcctggtaccggaatcttcgaagattccttctgaat |
41103099 |
T |
|
| Q |
206 |
cgccgattcaaaatcgg |
222 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
41103100 |
cgccgattcaaaatcgg |
41103116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University