View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6871A_low_224 (Length: 216)
Name: NF6871A_low_224
Description: NF6871A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6871A_low_224 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 151; Significance: 5e-80; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 23 - 189
Target Start/End: Original strand, 6917429 - 6917595
Alignment:
| Q |
23 |
cagttctgcaacaggaaacaggtactatccggagacgagtttgaagccgggagcacttcgctccccatacagaggtcacaactgtccagaaaggcaagtt |
122 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
6917429 |
cagttctgcaacagggaacaggtactatccggagacgagtttgaagccgggagcacttcgctccccatacagaggtcacaactgtccagaatggcaagtt |
6917528 |
T |
|
| Q |
123 |
ccaggccatcaagattgagcgcggcgaggttgattccgaaacatataggttctgattttccttttgc |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
6917529 |
ccaggccatcaagattgagcgcggcgaggttgatttcgaaacatataggttctgattttccatttgc |
6917595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 188 - 216
Target Start/End: Complemental strand, 6917626 - 6917598
Alignment:
| Q |
188 |
gcattttatattgagtgtgctcaaacaac |
216 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6917626 |
gcattttatattgagtgtgctcaaacaac |
6917598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University