View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6871A_low_233 (Length: 211)
Name: NF6871A_low_233
Description: NF6871A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6871A_low_233 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 66; Significance: 2e-29; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 98 - 196
Target Start/End: Original strand, 10795253 - 10795363
Alignment:
| Q |
98 |
taagaaacctccctcggcaaattgtcctccaccaccatc------------atcatcatcaccatatgtatacatgactggaccgccggggaatctgtat |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10795253 |
taagaaacctccctcggcaaattgtcctccaccaccatcatcaccatcatcatcatcatcaccatatgtatacatgactggaccgccggggaacctgtat |
10795352 |
T |
|
| Q |
186 |
ccagttgatgt |
196 |
Q |
| |
|
||||||||||| |
|
|
| T |
10795353 |
ccagttgatgt |
10795363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University