View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6871A_low_235 (Length: 208)
Name: NF6871A_low_235
Description: NF6871A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6871A_low_235 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 17 - 195
Target Start/End: Complemental strand, 18256611 - 18256433
Alignment:
| Q |
17 |
gacatcaatgtattgatcagtttcatccaatatatcttccttggatagtgaaaacaactatgtattagcaatcttatttatagaataaactgtattaaca |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
18256611 |
gacatcaatgtattgatcagtttcatccaatatatcttccttgaataatgaaaacaactatgtattagcaatcttatttatagtataaattgtattaaca |
18256512 |
T |
 |
| Q |
117 |
tgtgaaaatcgaattgctaattatttttataaggtgtctataatgataagaaagacaaacacagatgcgaacaccaaac |
195 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
18256511 |
tgggaaaatcgaattgctaattatttttataaggtgtctataatgataagaaagataaacacagatgcgaacactaaac |
18256433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University